207 Editing of prostaglandin E2 gene receptors EP2 and EP4 by CRISPR/Cas9 technology in equine adipose mesenchymal stem cells

Abstract

Prostaglandin E₂ (PGE₂) is an important mediator of cellular responses, playing a key role in limiting inflammation. PGE₂ acts distinctly through one of four EP receptors. In MSCs, it PGE₂ stimulation of EP2 and EP4 receptors triggers processes such as migration, self-renewal, survival, and proliferation, and their activation is involved in homing. PGE₂ has been proposed as a key factor of MSC immunomodulation. The CRISPR-Cas9 system has been adapted successfully to edit the genome of animals. Loss of EP2 and EP4 receptors in equine adipose mesenchymal stem cells (eAT-MSC) could help us understand their role in cell migration, homing, and self-renewal capacities. Here, we aimed to edit these receptors in eAT-MSC to test their function. The eAT-MSC were obtained from three Chilean breed horses and cultured in Dulbecco's modified Eagle's medium-high glucose with 10% fetal bovine serum. Guide RNAs (sgRNA) for CRISPR-Cas 9 editing were designed based on EP2 and EP4 DNA sequences. The sgRNA and PAM sequence targeting exon 1 of the equine genes (EP2-sgRNA: TGGTGCTGGCTTCGTACGCG; PAM:CGG and EP4-sgRNA: GGAGACGACCTTCTACACGT;PAM:TGG) were cloned into linearized LentiCRISPRv2GFP vector (#82416; Addgene). The lentiviral vector plus helping packaging plasmids was co-transfected into HEK293FT cells. The produced viral particles were harvested and transduced into eAT-MSC. After 48 h, cells were sorted and green fluorescent protein (GFP)-positive cells were expanded to obtain individual clones. Genomic DNA was extracted for PCR amplification, and the frequency of site directed-mutation was assessed by T7 endonuclease assay. Because of the high background (e.g. excessive banding) produced by the T7E1 assay, the PCR products were cloned into a pUC57 vector, and sequenced. Quantitative PCR and immunocytochemistry staining examined expression of EP2 and EP4. The statistical analyses were performed using GraphPad Prism 6 (GraphPad Inc.) with unpaired t-test; P-values < 0.05 were considered statistically significant. Transduction efficiency of eAT-MSC/EP2ko and eAT-MSC/EP4ko was 31 and 38%, respectively. A total of 15 clones for each lineage obtained from a single cell culture were subjected to T7EI assay to identify the frequency of mutation. Eight eAT-MSC/EP2ko and 7 eAT-MSC/EP4ko clones showed mutations; DNA sequencing confirmed mutations in 3 eAT-MSC/EP2ko clones and 3 eAT-MSC/EP4ko clones. Immunostaining with specific anti-EP2 and anti-EP4 antibodies showed diminished expression of the particular receptors in the knockout cells. Decreased expression was quantitatively confirmed by quantitative PCR analysis, showing downregulation of PTGER2 (4.3-fold) and PTGER4 (2.7-fold) in the edited clones compared with eAT-MSC naïve cells (P < 0.05). This CRISPR/Cas9 design allows the possibility of using these mutant cell lines as a model system to elucidate the role of EP2 and EP4 in cell migration, homing, and self-renewal.

Research was supported by FONDECYT 3170390 to ACFM, Ministry of Education, Chile.