Dietary chromium-methionine supplementation and broiler (22–43 days) responses during heat stress. 2 - Physiological variables, and heat shock protein 70 and insulin-like growth factor-1 gene expression
Felipe Santos Dalólio
A , Luiz Fernando Teixeira Albino B , Haniel Cedraz de Oliveira B , Alba Kyonara Barbosa Alves Tenorio Fireman C , Alvaro Burin Junior C , Marcos Busanello D , Nilton Rohloff Junior E , Guilherme Luis Silva Tesser E * and Ricardo Vianna Nunes E
A
B
C
D
E
Abstract
Dietary supplementation with trace mineral chromium (Cr) has been shown to enhance the physiological responses of broilers subjected to heat stress (HS), modulate gene expression, and improve performance.
This study aimed to evaluate the impact of chromium–methionine (CrMet) supplementation on growth performance, body temperatures, lymphoid organ weights, hormones, blood parameters, and the expression of heat-shock protein-70 (HSP-70) and insulin-like growth factor-1 (IGF-1) genes in broilers under HS conditions (33°C for 12 h/day).
In the first experiment, 336 22-day-old male broilers were randomly distributed into four blocks with six treatments (0, 0.10, 0.20, 0.40, 0.80, and 1.20 mg/kg CrMet) and eight replicates with seven birds per cage. These broilers were subjected to HS from 22 to 43 days of age. In the second experiment, 24 male broilers, in total, at 43 days of age, previously exposed to HS, were randomly distributed to the same six treatments from the first experiment, with four replicates. Breast samples were collected for the analysis of HSP-70 and IGF-1 expression.
A quadratic effect (P < 0.05) was observed on bodyweight gain (BWG) and feed conversion ratio (FCR). The supplementation of 0.71 and 0.68 mg/kg improved BWG and FCR, respectively. At 28 days of age, cloacal and mean body temperatures, corticosterone, and thyroid hormones were quadratically affected (P < 0.05), while at 43 days of age, a linear effect (P < 0.05) was observed on haemoglobin concentration. There was a reduction (P < 0.05) in the expression of HSP-70 and an increase in IGF-1 (P < 0.05) in the breast tissue of broilers supplemented with CrMet.
The supplementation with 0.71 mg/kg and 0.68 mg/kg of CrMet improved BWG and FCR, respectively. Additionally, the supplementation with 0.80 mg/kg improved hormones, reduced HSP-70 and increased the expression of IGF-1 in broilers during HS.
These findings suggest that CrMet can be included in the diet of broiler chickens subjected to HS to enhance physiological responses and performance.
Keywords: animal physiology, animal production, growth performance, heat stress, hormones, mineral nutrition, organic mineral, trace mineral.
Introduction
Heat stress (HS) has a significant impact on broiler production, especially in tropical and subtropical regions (He et al. 2018). The adverse effects on broiler performance result from complex endocrine and metabolic physiological adjustments triggered by HS (Wasti et al. 2020). From these mechanisms, it can be inferred that animals regulate their feed consumption on the basis of their ability to dissipate heat generated by metabolism. As a result, environmental conditions, genetic factors, and nutrient supply play pivotal roles in optimising physiological responses (Das et al. 2016).
Recent literature has indicated that HS results in decreased broiler growth, compromised immune responses, and disruptions in hormone and blood metabolite concentrations, all of which are critical factors for broiler health (Kumari and Nath 2018; Saleh et al. 2018; Safwat et al. 2020; Dalólio et al. 2021). Understanding these effects is essential for developing strategies to mitigate the economic losses associated with HS in the broiler industry.
Chromium (Cr) is not classified as an essential trace mineral for livestock (Vincent 2017), and it is infrequently included in monogastric premix formulation. Nevertheless, recent research suggests that Cr may play crucial nutritional and physiological role in broilers (Sahin et al. 2017, 2018). Chromium supplementation has demonstrated positive influence on insulin sensitivity in cells through the low-molecular-weight Cr-binding-substance (LMWCr) (Vincent, 2000, 2010). This effect stimulates cellular anabolism and influences carbohydrate, lipid, and protein metabolism, resulting in an increase in the apparent metabolisable energy corrected for nitrogen in the diet (Anderson 1997; Lu et al. 2019; Dalólio et al. 2021).
Furthermore, Cr supplementation has been shown to elevate triiodothyronine (T3) and thyroxine (T4) concentrations while reducing serum corticosterone (COR) in broilers exposed to HS, leading to improvements in their growth performance (Sahin et al. 2002, 2003; Bharami et al. 2012). Studies conducted by Ghazi et al. (2012) and Jahanian and Rasouli (2015) indicated that HS results in increased COR concentrations and decreased lymphatic tissue, compromising immunity and reducing broiler performance.
Heat stress in broilers promotes cellular damage, and the expression of heat-shock protein (HSP) can serve as an indicator of decreased performance in response heightened oxidative stress (Akdemir et al. 2015). Rajkumar et al. (2018) reported reduction of HSP-70 expression in heart, liver, muscle, and spleen of broilers reared under HS and fed Cr-yeast in the diet. Chromium up-regulates cell signalling to recognise insulin (Vincent, 2000, 2017). Insulin-like growth factor-1 (IGF-1) is important for protein synthesis and to decrease proteolysis in broilers, especially under HS (Sacheck et al. 2004). Researchers have not investigated gene expression of IGF-1 and HSP-70 in the breast of broilers exposed to HS and fed diet supplemented with chromium–methionine (CrMet).
The present study is a continuation of the results evaluated by Dalólio et al. (2021), where the authors investigated the effect of CrMet supplementation on growth performance and carcass yield, metabolisable energy, and serum biochemistry. Thus, the study aimed to evaluate the effect of supplementing CrMet during HS on body temperature, lymphoid tissues, hormone profiles, haemogram, and gene expression of HSP-70 and IGF-1.
Materials and methods
All procedures utilised in the present study were approved by the Ethics and Research Committee of the Federal University of Viçosa, Viçosa, Brazil (Protocol Number 15/2016). As highlighted, the current investigation extends the findings assessed by Dalólio et al. (2021). Accordingly, the same animals, experimental design, dietary treatments, and management procedures were utilised, while introducing variations solely in the evaluated variables.
Experiment 1
Three hundred and thirty-six 22-day-old male Cobb 500® broilers with average bodyweight (BW) of 858.20 g (±42 g) were used in the study. The birds were maintained under thermal comfort conditions from Day 1 to Day 21, following the guidelines outlined in the Cobb 500® Broiler Management Guide (Cobb-Vantress 2013). During the periods from 1 to 7, 8 to 14, and 15 to 21 days of age, ambient temperatures averaged 32.1°C, 29.8°C, and 26.9°C respectively. Birds were fed a common starter diet according to the nutritional recommendations by Rostagno et al. (2011) (Table 1).
| Ingredient | 1 to 21 days (%) | 22 to 43 days (%) | |
|---|---|---|---|
| Corn | 59.742 | 63.741 | |
| Soybean meal (45%) | 34.139 | 30.260 | |
| Soybean oil | 1.835 | 2.650 | |
| Dicalcium phosphate | 1.717 | 1.156 | |
| Limestone | 1.040 | 0.816 | |
| Salt | 0.455 | 0.440 | |
| DL-methionine (99%) | 0.235 | 0.209 | |
| L-lysine HCl (79%) | 0.204 | 0.136 | |
| Choline chloride (60%) | 0.100 | 0.100 | |
| Vitamin supplement A | 0.100 | 0.100 | |
| Mineral supplement B | 0.100 | 0.100 | |
| Salinomycin 12% C | 0.055 | 0.055 | |
| Avilamycin 10% D | 0.010 | 0.010 | |
| BHT E | 0.010 | 0.010 | |
| Phytase F | 0.007 | 0.007 | |
| Inert filler G | 0.251 | 0.210 | |
| Total | 100.00 | 100.00 | |
| Calculated composition | |||
| Crude protein (%) | 21.000 | 19.000 | |
| Metabolisable energy (kcal/kg) | 2950 | 3100 | |
| Digestible lysine (%) | 1.140 | 1.005 | |
| Digestible methionine + cystine (%) | 0.807 | 0.733 | |
| Digestible threonine (%) | 0.700 | 0.654 | |
| Calcium (%) | 0.890 | 0.683 | |
| Non-phytate phosphorus (%) | 0.420 | 0.319 | |
| Sodium (%) | 0.210 | 0.190 |
During the experimental period, from 22 to 43 days of age, HS was induced by maintaining broilers in climatic chambers at a temperature of 33.0 ± 0.8°C for 12 h (7:00 am to 6:59 pm). Subsequently, broilers were subjected to a temperature of 23.0 ± 0.8°C (7:00 pm to 06:59 am). Relative humidity was maintained at 65.0 ± 3.5% throughout the entire experimental period.
Boilers had ad libitum access to mash feed and water, and mortality was recorded daily. The light program consisted of 20 h of artificial light and 4 h of darkness from 22 to 43 days of age, with three fluorescent lamps installed per chamber.
Experiment 1 employed a randomised complete-block design with four blocks (each block comprised a climatic chamber), six treatments, eight replicates (2 replicates per block), and seven birds per experimental unit. The treatments involved varying concentrations of CrMet (Availa® Cr 1000, Zinpro Corporation, Eden Prairie, MN, USA) in the basal diet for 22–43-day-old broilers, following nutritional recommendations by Rostagno et al. (2011). Specifically, the six CrMet inclusion concentrations were 0.00, 0.10, 0.20, 0.40, 0.80, and 1.20 mg/kg.
The hypothesis to assess the dosages of CrMet used in the study was based on a previously published review article by Dalólio et al. (2018), in which the average maximum dose of 1.099 mg/kg of Cr, regardless of the source used, was optimum to improve physiological variables.
Chemical composition of diets and Cr analysed are shown in Table 2. To determine the DM in basal diet, samples were dried at 105°C for 16 h (AOAC 2006, Method 934.01) in a drying oven. Nitrogen (N) was determined by the total combustion of sample, and the Dumas method (AOAC 2006, Method 968.06) was used to calculate the crude protein (CP) content (N × 6.25). Ether extract (EE) was determined by Soxhlet method (Method 920.39), and the ash content was measured by burning the samples at 650°C for overnight (Method 942.05). Crude fibre (CF) was determined according to AOAC (2006, Method 962.09). Calcium (Ca) and phosphorus (P) were determined according to AOAC (2006, Methods 984.01 and 965.17 respectively). The Cr quantification was performed using atomic absorption spectrophotometry (Williams et al. 1962).
| Nutrient | Nutrient (%) | Chromium (mg/kg) | ||
|---|---|---|---|---|
| Analysed | Formulated | Analysed | ||
| Dry matter | 90.40 | 0 (Control diet) | – | |
| Crude protein | 19.30 | 0.10 | 0.12 | |
| Ethereal extract | 5.65 | 0.20 | 0.18 | |
| Crude fibre | 2.57 | 0.40 | 0.35 | |
| Calcium | 0.69 | 0.80 | 0.76 | |
| Phosphorus | 0.65 | 1.20 | 1.24 | |
At 28 and 42 days of age, temperatures of comb, head, wattle, back, wing, breast and legs were measured using an infrared thermometer (Model TI-870, Instrutherm®, São Paulo, SP, BR). Subsequently, mean skin temperature (MST, °C) was calculated using the following equation:
where Tcomb = crest temperature (°C); Tback = back temperature (°C); Twing = wing temperature (°C); Thead = head temperature (°C); Tleg = leg temperature (°C) described by Richards (1971). Cloacal temperature (CT, °C) was mensured using a digital thermometer with accuracy of ±0.1°C. Mean body temperature (MBT, °C) was calculated using the following equation described by Richards (1971):
At Day 43, two broilers per replicate (total of 96 birds, 16 per treatment) were selected within ±5% of the pen average BW, euthanised by electronarcosis and bled by ventral neck cutting, and absolute and relative weight of bursae and spleen were measured. Relative weight of lymphoid organs was calculated as a function of carcass weight, as follows:
At 43 days of age, blood samples were obtained from two broilers selected within ±5% of the pen average BW (total of 96 broilers, 16 per treatment) for analyses of T3, T4, and corticosterone hormones in addition to complete blood count (erythrograms and leukograms). Blood sample was taken by cardiac punch and stored in polyethylene tubes. After coagulation, tubes were centrifuged at 3220g for 15 min and 4°C temperature. Serum obtained was then stored at −80°C until hormone analyses.
Hormonal analyses were performed by radioimmunoassay (RIA) analyses by using iodine-labelled commercial kits; analyses followed supplier recommendations for each hormone. Corticosterone serum concentrations were determined by RIA by using an ImmunoChem Double Antibody Corticosterone 125I RIA Kit (MP Biomedicals LLC, Orangeburg, NY, USA). The concentrations of hormones T3 and T4 were determined using commercially available RIA kits (Byk-Sangtec Diagnostica, Dietzenbach, HE, DE).
Hematocrit was measured by microhematocrit method, in which capillary tube was centrifuged (room temperature; 20°C) at 11.360g for 5 min in a microcentrifuge. Mean corpuscular volume, mean corpuscular haemoglobin, erythrocyte, monocyte, eosinophil, and leucocyte counts were measured by a haemocytometer, in which blood samples were diluted to 1:200 in Natt–Herrick’s dye (Vetlab, Palmetto Bay, FL, USA). Haemoglobin (Hmo) concentration was measured using the cyanmethaemoglobin method (Bioclin enzymatic kit, Bioclin, Belo Horizonte, MG, BR) by using a spectrophotometer for measuring absorbance. The differential leukocyte count was performed on blood smear, fixed with methyl alcohol (methanol) and later it was stained with fast dye for haematology (fast panoptic). From the results, the heterophile (H):lymphocyte (L) ratio (H:L) was determined for the identification of HS in broilers and its association with the immune system.
Experiment 2
At the end of Experiment 1, 24 43-day-old male Cobb 500® broilers, in total, with an average BW of 2500.50 g (±50 g), were reared under a completely randomised experimental design with six treatments and four animals per treatment, and kept at 33°C for 12 h. Treatments consisted of the basal diet with one of six CrMet concentrations (Table 1) formulated for 22–43-day-old broilers, according to nutritional recommendations of Rostagno et al. (2011). The six CrMet inclusion concentrations were 0.00, 0.10, 0.20, 0.40, 0.80 and 1.20 mg/kg (Availa® Cr 1000, Zinpro Corporation, Eden Prairie, MN, USA).
To investigate the gene expression of HSP-70 and IGF-1 in the Pectoralis major muscle, broilers were subjected to a 12-h period of HS at 33°C. Afterwards, broilers were stunned and subsequently slaughtered by bleeding and their pectoral skin was removed. Immediately after this process, a sample of approximately 2.0 cm in length, 0.5 cm in width and 0.5 cm in depth of the right Pectoralis major muscle was collected in the central region of the muscular part. Subsequently, identified samples were immersed in RNA holder (BioAgency) and stored in a freezer at −20°C until extraction for the analysis of HSP-70 expression and IGF-1 mRNA gene expression.
Total mRNA from each sample was extracted using the RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions. The concentration of total mRNA was determined using the Nano Vue Plus (GE Healthcare) spectrophotometer. The integrity of RNA was assessed using 1% agarose gel and visualised by ultraviolet light. The cDNA was synthesised using the SuperScriptTM III First-Strand Synthesis Super Mix kit (Invitrogen). Volumes of 6 μL of the total mRNA, 50 μM oligo (dT)20, and 1 μL of annealing buffer were added. The mixture was incubated for 5^^min at 65°C and then placed on ice for 1 min. After, 10 μL of 2× First-Strand Reaction Mix solution and 2 μL of SuperScript III reverse transcriptase enzyme were added. Samples were stored at −20°C until analysis.
Gene sequences were obtained from the NCBI database (www.ncbi.nlm.nih.gov). Table 3 displays the sequences of the primer set. The primers were designed according to sequences obtained from GeneBank, by using the PrimerQuest Tool (www.idtdna.com/Primerquest/Home/Index) available on the IDT platform (www.idtdna.com). Two endogenous controls, the β-actin and GAPDH genes, were used. The GAPDH gene was used as endogenous control because there was less variation in relation to β-actin, when the GeNorm program was used (Vandesompele et al. 2002). All assays were performed in a final volume of 25 μL and in duplicate.
| Gene | GeneBank ID | Sequence 5′ → 3′ | Product size (bp) | |
|---|---|---|---|---|
| HSP-70 | J02579 | CGTGACAATGCTGGCAATAAGCGA TCAATCTCAATGCTGGCTTGCGTG | 95 | |
| IGF-1 | M32791 | CACCTAAATCTGCACGCT CTTGTGGATGGCATGATCT | 191 | |
| β-actin | NM_205518 | AGACATCAGGGTGTGATGGTTGGT TCCCAGTTGGTGACAATACCGTGT | 150 | |
| GAPDH | NM_204305 | CCCAGCAACATCAAATGGGCAGAT TGATAACACGCTTAGCACCACCCT | 133 |
The fluorescence compound SYBR® Green PCR Master Mix (Qiagen) was used for real-time polymerase chain reaction (RT-PCR). The RT-qPCR reaction was run by using the SYBR Green detection kit with GoTaq qPCR Master Mix (Promega, Madison, WI, USA), using specific primers. Gene amplification was performed in duplicate by using the Quick Time PCR 7500 Fast (Applied Biosystems, Foster City, CA, USA) and the results were obtained with the Sequence Detection Systems program (V.2.0.6) (Applied Biosystems, Foster City) that generated the parameter cycle threshold (Ct). The Ct values were exported to Microsoft Excel to calculate the Ct mean, standard deviation, and standard curve for each gene. A negative control (distilled water) was also added in each assay. The qPCR reaction conditions were defined as follow: initial denaturation at 95°C for 10 min and 40 cycles of denaturation at 95°C for 15 s. The temperature range between 60°C and 64°C for 1 min was ideal for all primers.
Statistical analyses
Data were subjected to variance and regression analyses. The residuals from the models for all variables were submitted to assumption tests. Residual normality was verified on the basis of visualisation of histograms, quantile–quantile plots, and the Shapiro–Wilk’s test. Residual independence was verified through graphics of predicted versus residual values.
Homogeneity of variances was verified through box-plot graphs and the Levene’s test. In general, all the assumptions were met for all the variables with some exceptions. When an assumption was not met, an exclusion of extreme values was performed on the basis of the standardised residuals, where values outside the range of ±3 were excluded (representing 3 standard deviations from the mean, which is zero). Such an approach solved the problems and resulted in meeting the assumptions.
Following, the regression effects (linear and quadratic) were tested using orthogonal contrasts. When a quadratic effect was obtained, the point of maximum/minimum dietary CrMet concentration was calculated. After performing the linear regressions for all the variables, non-linear regressions were performed when the variables presented P-values < 0.10 with linear (LBL) and quadratic. When linear polynomial regressions or non-linear regressions (LBL and QBL) were significant, the coefficient (R2) and root mean squared error (RMSE) were presented for comparisons. All the analyses were performed in the SAS statistical software, version 9.0 (SAS Institute, Inc., Cary, NC, USA, 2012). ANOVA, regression, and orthogonal contrasts were performed using the SAS PROC MIXED. Assumptions of residual normality, homogeneity and independence were made using SAS PROC UNIVARIATE, SAS PROC GLM and SAS PROC REG, respectively. Non-linear regression models (LBL and QBL) were performed using SAS PROC NLIN. Significance was considered at the level of P < 0.05 (5%) of probability.
In Experiment 2, to perform statistical analyses of gene expression data, a %QPCR_MIXED macro (Steibel et al. 2009) was used in SAS statistical software, version 9.0 (SAS Institute, Inc., Cary, NC, USA, 2012). This macro analyses data were performed using a mixed linear models of RT–qPCR data. This analysis standardises data by using the method ΔΔCT (Livak and Schmittgen, 2001), generating contrasts which are the differences between the control and other treatments (Fu et al. 2006). To determine differences among treatments (CrMet levels), contrast analyses were performed. In this statistical model, CrMet concentrations (0; 0.10; 0.20; 0.40; 0.80 and 1.20 mg/kg) were considered a fixed effect, and genes were considered random effect. In this way, all possible comparisons between levels of these factors were tested. Statistical differences were set at P < 0.05.
Results
No Cr was detected in the control diet (Table 3). The analysed Cr concentrations in the experimental diets were close to the calculated concentrations for the experimental treatments.
Table 4 presents the effects of increasing dietary concentrations of CrMet on growth performance of heat-stressed broiler chickens from 22 to 43 days of age. The results showed that there were no significant effects on feed intake (FI) (P > 0.05). However, a quadratic effect was observed on BWG (P = 0.01) and FCR (P < 0.01).
| Variable | Concentration of CrMet (mg/kg) | s.e.m. | P-value | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 0.10 | 0.20 | 0.40 | 0.80 | 1.20 | L | Q | |||
| FI | 2847 | 2806 | 2831 | 2837 | 2824 | 2846 | 19.42 | 0.52 | 0.43 | |
| BWG | 1471 | 1571 | 1545 | 1589 | 1530 | 1561 | 18.92 | 0.06 | 0.01 | |
| FCR | 1.94 | 1.79 | 1.84 | 1.79 | 1.85 | 1.82 | 0.03 | 0.11 | <0.01 | |
P-values show the significance of the regression effects from orthogonal contrasts.
Table 5 shows the effects of dietary CrMet on broiler body temperature variables. At Day 28, there was a quadratic effect (P = 0.03) of CrMet supplementation on cloacal temperature and a linear decrescent effect (P = 0.04) on mean body temperature. There were no significant (P > 0.05) effects of CrMet supplementation on mean skin temperature at Day 28, and on cloacal temperature, mean body temperature, and mean skin temperature at 42 days of age.
| Item | Concentration of CrMet (mg/kg) | s.e.m. | P-value | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 0.10 | 0.20 | 0.40 | 0.80 | 1.20 | Linear | Quadratic | |||
| 28 days | ||||||||||
| CT (°C) | 41.87 | 40.81 | 42.05 | 42.15 | 41.99 | 41.81 | 0.13 | 0.72 | 0.03 | |
| MST (°C) | 36.60 | 36.98 | 36.36 | 35.60 | 36.49 | 35.99 | 0.43 | 0.13 | 0.31 | |
| MBT (°C) | 40.38 | 40.36 | 40.34 | 40.18 | 40.34 | 39.97 | 0.19 | 0.04 | 0.54 | |
| 42 days | ||||||||||
| CT (°C) | 42.60 | 42.63 | 42.24 | 42.30 | 42.61 | 42.48 | 0.23 | 0.97 | 0.56 | |
| MST (°C) | 33.74 | 33.53 | 33.78 | 34.30 | 33.98 | 33.73 | 0.45 | 0.70 | 0.11 | |
| MBT (°C) | 39.94 | 39.90 | 39.70 | 39.86 | 40.02 | 39.85 | 0.20 | 0.83 | 0.92 | |
P-values show the significance of the regression effects from orthogonal contrasts.
Table 6 shows the effects of increasing dietary concentration of CrMet on lymphoid organs of broilers. The supplementation of CrMet did not have a statistically significant (P > 0.05) effect on the absolute and relative weights of lymphoid organs at Day 43.
| Variable | Concentration of CrMet (mg/kg) | s.e.m. | P-value | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 0.10 | 0.20 | 0.40 | 0.80 | 1.20 | Linear | Quadratic | |||
| Absolute (g) | ||||||||||
| Spleen | 1.53 | 1.85 | 2.01 | 1.75 | 1.77 | 1.93 | 0.12 | 0.27 | 0.73 | |
| Bursa | 3.15 | 3.72 | 3.26 | 3.30 | 3.64 | 3.58 | 0.28 | 0.35 | 0.90 | |
| Relative (%) | ||||||||||
| Spleen | 0.08 | 0.09 | 0.11 | 0.09 | 0.09 | 0.10 | 0.01 | 0.30 | 0.64 | |
| Bursa | 0.16 | 0.19 | 0.17 | 0.17 | 0.19 | 0.19 | 0.01 | 0.36 | 0.85 | |
P-values show the significance of the regression effects from orthogonal contrasts.
The effects of the increasing dietary concentration of CrMet on blood profile of broilers are presented on Table 7. There was a significant (P = 0.01) linear effect of supplemented CrMet on mean corpuscular haemoglobin concentration at Day 43. There were no significant (P > 0.05) effects on the other blood variables analysed.
| Haemogram | Concentration of CrMet (mg/kg) | s.e.m. | P-value | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 0.10 | 0.20 | 0.40 | 0.80 | 1.20 | Linear | Quadratic | |||
| Ery (106 μL) | 1.99 | 2.12 | 2.04 | 1.84 | 2.26 | 2.15 | 0.17 | 0.18 | 0.76 | |
| Hmo (g/dL) | 9.02 | 9.25 | 9.18 | 9.12 | 9.41 | 9.05 | 0.18 | 0.80 | 0.15 | |
| Hma (%) | 27.06 | 27.75 | 27.56 | 27.38 | 28.25 | 27.17 | 0.54 | 0.81 | 0.14 | |
| Mcv (cells/μL) | 135.17 | 135.25 | 142.93 | 154.19 | 128.12 | 121.43 | 11.16 | 0.07 | 0.09 | |
| Mch (g/dL) | 47.44 | 46.34 | 47.20 | 51.36 | 42.73 | 39.86 | 3.39 | 0.01 | 0.19 | |
| Leu (cells/μL) | 1617.12 | 1839.78 | 2145.01 | 1830.60 | 2191.41 | 1943.80 | 187.76 | 0.23 | 0.16 | |
| Mon, (cells/μL) | 54.17 | 70.24 | 54.02 | 65.11 | 48.12 | 57.25 | 14.64 | 0.71 | 0.85 | |
| Eos (cells/μL) | 32.23 | 45.86 | 33.96 | 30.32 | 48.31 | 47.29 | 18.20 | 0.25 | 0.78 | |
| H (cells/μL) | 576.00 | 578.00 | 617.88 | 639.50 | 655.56 | 580.06 | 73.54 | 0.81 | 0.29 | |
| L (cells/μL) | 1047.23 | 1084.53 | 1313.30 | 1114.54 | 1424.11 | 1261.43 | 137.63 | 0.11 | 0.29 | |
| H:L | 0.54 | 0.52 | 0.50 | 0.58 | 0.46 | 0.47 | 0.07 | 0.24 | 0.87 | |
P-values show the significance of the regression effects from orthogonal contrasts.
Ery, erythrocytes; Hmo, haemoglobin; Hma, haematocrit; Mcv, mean corpuscular volum; Mch, mean corpuscular haemoglobin; Leu, leukocytes; Mon, monocytes; Eos, eosinophils; H, heterophiles; L, lymphocytes; H:L, heterophiles:lymphocyte ratio.
Effects of the increasing dietary concentration of CrMet on hormones of broilers are presented on Table 8. There was a quadratic effect of CrMet supplementation on serum COR (P < 0.01), T3 (P < 0.01), and T4 (P < 0.01) of broilers at 43 days of age. There was no significant (P > 0.05) effect of CrMet supplementation on the T3:T4 ratio.
| Hormone (μg/dL) | Concentration of CrMet (mg/kg) | s.e.m. | P-value | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 0.10 | 0.20 | 0.40 | 0.80 | 1.20 | Linear | Quadratic | |||
| Corticosterone | 124.21 | 105.41 | 103.87 | 96.47 | 96.79 | 99.06 | 0.89 | <0.01 | <0.01 | |
| T3 | 46.15 | 57.25 | 61.21 | 56.86 | 58.27 | 56.52 | 3.16 | 0.23 | 0.04 | |
| T4 | 1.26 | 1.42 | 1.54 | 1.48 | 1.51 | 1.52 | 0.06 | 0.02 | 0.05 | |
| T3:T4 | 37.01 | 40.62 | 39.81 | 38.55 | 38.86 | 37.87 | 1.91 | 0.64 | 0.48 | |
P-values show the significance of the regression effects from orthogonal contrasts.
The equations for each variable, with the respective adjusted model are presented in the Table 9. Considering the growth performance, the QR model estimated concentrations of 0.71 and 0.68 mg/kg of CrMet to optimise BWG and FCR respectively.
| Variable | Model | Equation of regression | R2 | RMSE | Min./max. | P-value | |
|---|---|---|---|---|---|---|---|
| Growth performance | |||||||
| Bodyweight gain | QR | y = 1514.2 + 165.68 × x − 116.2 × x2 | 0.25 | 51.4 | 0.71 | 0.01 | |
| Feed conversion ratio | QR | y = 1.8745 − 0.2228 × x + 0.163 × x2 | 0.29 | 0.07 | 0.68 | 0.01 | |
| Body temperatures | |||||||
| CT 28 days | QR | y = 41.8417 + 0.903 × x − 0.7888 × x2 | 0.24 | 0.31 | 0.572 | 0.03 | |
| MBT 28 days | LR | y = 40.3853 − 0.2728 × x | 0.35 | 0.37 | – | 0.04 | |
| Haemogram | |||||||
| Mch (g/dL) | LR | y = 48.7643 − 6.4847 × x | 0.17 | 10.67 | – | 0.01 | |
| Hormones (μg/dL) | |||||||
| Corticosterone | QR | y = 117.7–67.7576 × x + 44.7811 × x2 | 0.72 | 5.39 | 0.757 | <0.01 | |
| Corticosterone | LBL | y = 97.4389 + 101.7 × (0.2349 − x) | 0.81 | 4.43 | 0.235 | <0.01 | |
| Corticosterone | QBL | y = 97.857 + 296.3 × (0.2919 − x)2 | 0.85 | 3.94 | 0.292 | <0.01 | |
| T3 | QR | y = 51.3536 + 27.2631 × x − 19.8608 × x2 | 0.06 | 12.69 | 0.686 | 0.04 | |
| T3 | LBL | y = 58.2145 − 111 × (0.1087 − x) | 0.12 | 12.32 | 0.109 | <0.01 | |
| T3 | QBL | y = 58.2145 − 620.4 × (0.1395 − x)2 | 0.12 | 12.32 | 0.140 | <0.01 | |
| T4 | LR | y = 1.4213 + 0.1333 × x | 0.07 | 0.25 | – | 0.02 | |
| T4 | LBL | y = 1.5098 − 1.5937 × (0.1575 − x) | 0.14 | 0.24 | 0.158 | <0.01 | |
| T4 | QBL | y = 1.5084 − 5.008 × (0.2248 − x)2 | 0.14 | 0.24 | 0.225 | <0.01 | |
LR, linear regression model: y = β0 + β1 × (β2 – X), where y is the response variable, X is the dietary CrMet concentration, β0 is the intercept and β1 is the linear coefficient of the regression; QR, quadratic polynomial regression model: y = β0 + β1 × X + β2 × X2, where y is the response variable, X is the dietary CrMet concentration, β0 is the intercept, β1 and β2 are the linear and quadratic coefficients of the regression, respectively [maximum response concentration was obtained by: −(β1/2 × β2)]; LBL, linear broken-line regression model: y = β0 + β1 × (β2 – X), where (β2 – X) = 0 for X > β2, y is the response variable, X is the dietary CrMet concentration, β0 is the value at the plateau, β1 is the slope and β2 is the dietary CrMet concentration at the break point; QBL, quadratic broken-line model: y = β0 + β1 × (β2 − X)2, where (β2 − X) = 0 for X > β2, y is the response variable, X is the dietary CrMet concentration, β0 is the value at the plateau, β1 is the slope and β2 is the dietary CrMet concentration at the break point.
P-values show the significance of the linear regression effects from orthogonal contrasts when model is equal to LR or QR, and significance of the non-linear effects (SAS PROC NLIN) when model equal is to LBL or QBL.
R2, determination coefficient for the regression equation; RMSE, root mean squared error; CT, cloacal temperature; MBT, mean body temperature; Mch, mean corpuscular haemoglobin; T3, triiodothyronine; T4, thyroxine.
For the body temperature variables, QR model estimated the concentration of 0.57 mg/kg DM Cr as CrMet supplemented for cloacal temperature at 28 days of age.
At Day 43, for serum COR concentrations, the QR, LBL, and QBL equations estimated supplemented CrMet concentrations of 0.75, 0.23, and 0.29 mg/kg respectively. The LBL model was selected as the best fit because of its higher R2 and RMSE values, as well as the lower CrMet inclusion in the diets required to achieve the desired reduction in serum COR. In terms of serum T3 concentrations at Day 43, the estimated supplemented CrMet concentrations by the QR, LBL, and QBL equations were 0.68, 0.10, and 0.14 mg/kg respectively. The LBL model was the preferred choice owing to its higher R2 and RMSE values and its lower CrMet supplementation requirement to attain higher serum T3 concentrations. Regarding serum T4 concentrations, the LBL and QBL equations estimated supplemented CrMet concentrations of 0.15 and 0.22 mg/kg, respectively. The LBL model was chosen, because of its higher R2 and RMSE values and the lower CrMet content needed in the broiler diets to elevate T4 serum concentrations.
Effects of the increasing dietary concentrations of CrMet on HSP-70 and IGF-1 expression are presented on Table 10. There were significant (P < 0.05) effects of CrMet supplementation on the relative expression of HSP-70 in the breast of broilers at all supplement concentrations in comparison to the control diet (0 mg/kg de CrMet). The lowest HSP-70 expression was found with the inclusion level of 0.80 mg/kg CrMet. There were significant (P < 0.05) effects on the relative expression of IGF-1 in the breast of broilers supplemented with 0.80 and 1.20 mg/kg CrMet compared with those fed the control diet (0 mg/kg de CrMet). The highest IGF-1 expression was observed at the inclusion level of 0.80 mg/kg CrMet.
| Comparison among CrMet concentrations (mg/kg) | HSP-70 | IGF-1 | |||
|---|---|---|---|---|---|
| Fold change | P-value | Fold change | P-value | ||
| 0 vs 0.10 | 4.72 | <0.01* | 2.23 | 0.09 | |
| 0 vs 0.20 | 4.38 | <0.01* | 2.12 | 0.11 | |
| 0 vs 0.40 | 3.94 | <0.01* | 2.07 | 0.12 | |
| 0 vs 0.80 | 2.39 | 0.03* | 2.82 | 0.03* | |
| 0 vs 1.20 | 2.57 | 0.02* | 2.77 | 0.03* | |
| 0.10 vs 0.20 | −1.07 | 0.84 | −1.05 | 0.91 | |
| 0.10 vs 0.40 | −1.20 | 0.64 | −1.08 | 0.86 | |
| 0.10 vs 0.80 | −1.97 | 0.09 | 1.26 | 0.61 | |
| 0.10 vs 1.20 | −1.83 | 0.13 | 1.24 | 0.64 | |
| 0.20 vs 0.40 | −1.11 | 0.78 | −1.03 | 0.95 | |
| 0.20 vs 0.80 | −1.83 | 0.13 | 1.32 | 0.54 | |
| 0.20 vs 1.20 | −1.70 | 0.19 | 1.30 | 0.56 | |
| 0.40 vs 0.80 | −1.64 | 0.21 | 1.36 | 0.50 | |
| 0.40 vs 1.20 | −1.52 | 0.29 | 1.34 | 0.52 | |
| 0.80 vs 1.20 | −1.08 | 0.84 | −1.02 | 0.96 | |
*Significant (P < 0.05).
Discussion
Chromium is gaining recognition for its potential impact on the physiological variables of broiler chickens, resulting in enhanced performance (Hayat et al. 2020). In the current study, CrMet supplementation was found to improve BWG and FCR, with no significant effects on FI. These improvements may be attributed to its ability to enhance insulin action, thus promoting the utilisation of glucose and amino acids for growth (Sahin et al. 2010). Additionally, Cr is essential for proper glucose functioning and plays a crucial role in maintaining blood sugar concentrations (NRC 1997). Acting as the active component of chromodulin, it further enhances insulin signalling, potentially affecting carbohydrate metabolism (Vincent 2001; Almeida et al. 2010; Valente Junior et al. 2021). Furthermore, Cr facilitates the uptake of amino acids into tissues, resulting in more efficient muscle building (Anderson and Allen 1994). Previous studies have reported the beneficial effects of CrMet supplementation on broiler performance (Zheng et al. 2016; Arif et al. 2019; Dalólio et al. 2021; Youssef et al. 2022). However, it is important to note that Cr effects on growth performance can vary owing to factors such as different stress conditions, basal diets, nutrient content, and variations in Cr source (Ghazi et al. 2012). In the present study, the inclusions of 0.71 and 0.68 mg of CrMet were estimated to optimise BWG and FCR respectively.
Among body-temperature measurements in broilers, measuring cloacal temperature is crucial because it reflects the core body temperature (Phalen et al. 1996). Notably, Giloh et al. (2012) found that the cloacal temperature tends to remain stable regardless of external environmental conditions. However, Altan et al. (2003) observed that broilers exposed to HS might experience an increase in cloacal temperature. In the current study, cloacal temperature variation was observed, ranging from 40.81°C to 42.15°C at Day 28 and from 42.24°C to 42.63°C at Day 42. These findings align with previous research by Ryu et al. (2016), which reported a cloacal temperature range from 41°C to 42°C in adult birds. The linear increase in cloacal temperature at Day 28 with an increasing supplementation of CrMet could be attributed to an increase in metabolic rate, affecting the hormone concentrations. In contrast, Norain et al. (2013) noted a reduction in cloacal temperature and respiratory rate of broilers exposed to HS and fed diets containing 2.00 mg/kg of chromium chloride (CrCl3). Regarding the linear reduction in mean body temperature at Day 28 with increasing CrMet concentrations in the broiler diets, this might indicate that, despite the increase in cloacal temperature, birds exhibited a higher efficiency in heat exchange with the environment. This phenomenon is primarily observed in body parts not covered by feathers, such as feet, comb, and wattle, which are variables included in the mean body-temperature index. Although mean skin temperature is calculated on the basis of cloacal temperature and mean body temperature, no variations were observed in this parameter at Day 28. The lack of response to body temperature indices at Day 42 could be an indication of the adaptability of broilers to HS.
Heat stress induces immunosuppression in broilers, and the change in the weight of lymphoid organs (bursa, thymus, and spleen) is an indirect measure used to assess the condition of the immune system (Lu et al. 2019). In the present study, the supplementation of CrMet did not have a significant effect on the weight of lymphoid organs. Similar results were observed by Silva et al. (2014) for broilers fed diets supplemented with CrMet and reared under HS. However, Ghazi et al. (2012) observed an increase in the relative weight of the thymus and spleen in broilers under HS when they were supplemented with 1.20 mg/kg of CrMet and CrCl3. The variations in results across different studies may be attributed to several factors, including differences in facility environment and hygiene, local sanitary challenges, the severity of the stressor (heat or cold), dietary composition (such as the inclusion of exogenous enzymes, particularly phytase, electrolyte balance, and the use of synthetic amino acids), as well as the statistical models used for analysis (Dalólio et al. 2021).
The blood profile is particularly sensitive to temperature changes and may be a potential indicator of physiological responses of broilers exposed to HS (Altan et al. 2003). Quantitative and morphological changes in the blood cells of broilers are linked to HS, particularly affecting parameters such as hematocrit values, number of circulating leukocytes and erythrocytes, and the haemoglobin content in erythrocytes (Borges et al. 2003). In the present study, only the mean corpuscular haemoglobin content was altered as a result of CrMet supplementation. The mean corpuscular haemoglobin and mean corpuscular volume are indices used to measure the amount of haemoglobin per erythrocyte. These indices provide insights into the presence of anemia status and bone marrow’s ability to produce red blood cells of normal size and metabolic capacity (Campbell 1995).
Vincent (2010) proposed a possible explanation that Cr may compete with iron (Fe) for the same absorption site and transportation through the transferrin, potentially resulting in lower free circulating Fe and inducing anemia. However, in the current study, Cr was provided in a complex with methionine (Met), which is absorbed via active dependent co-transportation with sodium, thus Cr attached to Met would be absorbed together. The increase in the mean corpuscular haemoglobin observed in the present study, even in the context of possible anemia, should theoretically influence performance because the red blood cells are responsible for transporting oxygen and nutrients to the cells. However, this effect was not observed. In this way, to better understand the relationship between Cr supplementation, red blood-cell morphology, and the inflammatory response linked to protein content and concentrations in the blood of broilers, more research is needed. Regarding the inflammatory response in broilers under HS, Roll et al. (2010) emphasised the importance of the H:L ratio as a parameter for evaluating the immune process. Ebrahimzadeh et al. (2012) observed effects on the concentration of heterophiles and decrease in H:L in broilers exposed to HS and fed a diet containing 0.80 mg/kg of CrMet, suggesting an improvement in the immune response. However, in this study, the supplementation of CrMet did not significantly affect the H:L.
The supplementation of CrMet decreased circulating COR concentration, which was efficient in mitigating the deleterious effects of HS. Heat stress triggers the production of pro-inflammatory cytokines, such as interleukin 6, C-reactive protein and tumor necrosis-factor alpha (TNF-α), which in turn stimulate the hypothalamus to secrete corticotropic hormone that acts on the adrenal gland producing COR in broilers (Sahin et al. 2010; Ghazi et al. 2012). Increased concentrations of COR cause excess free radicals and suppress the proliferation of interleukin-2 (Siegel 1995; Rao et al. 2016), impairing immune response and performance.
According to Orhan et al. (2012) and Akdemir et al. (2015), Cr increases hepatic expression of protein IκBα and decreases free radical production and tumor necrosis factor-Kb in meat-type quails under HS. That results in reduction of transcription of genes forming apoptotic factors, which decreases proteolysis and lipid peroxidation in quails under HS. Rao et al. (2012, 2016) observed that supplementation with CrMet and Cr-yeast in broilers increased glutathione peroxidase, glutathione reductase, superoxide dismutase and catalase activity, which decreased plasma lipid peroxidation in broiler chickens raised under thermal comfort temperature and HS. Li et al. (2018) reported that supplementation of 0.20 mg/kg of CrPic increased superoxide dismutase and reduced malondialdehyde concentrations in heat-stressed ducks. Those results indicated that Cr can reduce the oxidative stress caused to the cells when birds are exposed to HS.
Ebrahimzadeh et al. (2012) observed that CrMet at all levels of inclusion studied decreased cortisol concentration of broiler chickens under HS. Bahrami et al. (2012) evaluated CrMet and CrCl3 supplementation in broilers raised in HS and observed a reduction of cortisol concentration at 42 days, with a more pronounced effect for the CrMet source. Contrarily, Jahanian and Rasouli (2015) observed that 1.00 mg/kg CrMet supplemented in diets of broilers under HS was not sufficient to reduce plasma COR and to restores lymphoid organ weights in comparison to broilers raised under thermal-comfort temperature.
In addition to reducing COR concentrations, Sahin et al. (2002) also observed an increase in T3 and T4 concentrations in broilers exposed to HS and fed diets supplemented with CrPic during the period from 21 to 42 days. Triiodothyronine is the active form of the hormone, whereas T4 serves as a reservoir for T3. Both hormones stimulate basal metabolism in animals and have a trophic effect on the intestinal mucosa (Daher et al. 2009; Martinez and Ortiz 2017). This, in turn, favoured an increase in apparent metabolisable energy, indicating a higher retention of nitrogen for growth in relation to gross energy of the diet. Consequently, this improvement in performance aligns with the findings from our research conducted by Dalólio et al. (2021). The precise mechanism through which Cr leads to an increase in T3 and T4 concentrations is not yet well elucidated. It could be related to indirect changes that enhance cellular sensitivity to insulin recognition, because it has been reported that insulin can affect the mechanisms of insulin resistance as well as T3 and T4 concentrations (Godini et al. 2015).
In HS conditions, the expression levels of HSP tend to increase, especially in fast-growing broilers (Cedraz et al. 2017). This increase in HSP occurs to assist the process of synthesis and maturation of new proteins, particularly in cells that have been damaged during exposure to HS (Gupta et al. 2007).
Reducing HSP-70 expression levels contributes to the reduction of oxidative stress in the breast of broilers. This is particularly significant in broilers with a high protein content, because they have elevated activity and heat production rates. Rajkumar et al. (2018) observed similar results when they evaluated the supplementation of 2.00 mg/kg of Cr-yeast, which led to a reduction in HSP-70 expression in the muscle, liver, heart, and spleen of broilers raised under HS compared with a control group that received 0 mg/kg of Cr-yeast. Ezzat et al. (2017) evaluated the supplementation of 1.20 mg/kg of CrPic and observed a reduction in HSP-70 in liver of broilers reared under HS in relation to control diet (0 mg/kg of CrPic). Akdemir et al. (2015) evaluated two levels of Cr-histidinate supplementation (0.40 and 0.80 mg/kg) in the diet of meat-type quails exposed to HS and observed a remarkable reduction of 29% in liver HSP-70 expression. Thus, supplementation of CrMet in the diet of modern fast-growing broiler strains is a viable alternative to mitigate oxidative stress in the breast of broilers, which may improve meat quality and yield.
Heat stress has also been reported to decrease IGF-1 expression and to accelerate the ubiquitin-proteasome metabolic pathways, resulting in proteolysis and increased metabolism. Decreased IGF-1 expression under conditions of oxidative stress can lead to proteolysis, diverting essential amino acids away from growth and towards other metabolic processes (Del Vesco et al. 2013). Although the liver is the primary organ responsible for IGF-1 expression in broilers under HS (Del Vesco et al. 2015), the breast muscle is also capable of considerable IGF-1 expression, significantly contributing for protein synthesis (Vignale et al. 2017; Wen et al. 2017). IGF-1 acts as a mediator of growth hormone (GH) and is directly linked to protein synthesis (Cruzat et al. 2008). Therefore, increased IGF-1 expression signifies that amino acids are being directed towards protein deposition and indicates a reduction in free radical production. Glucocorticoids, such as corticosterone, have an antagonistic effect on insulin action, whereas thyroid hormone (T3) is synergistic with insulin and tolerant to GH (Macari and Maiorka 2017). These factors collectively explain the beneficial effects of Cr on broiler metabolism, including increased insulin production and a reduction in plasma corticosterone concentration.
Heat stress has been shown to reduce the plasma concentration of Cr and its deposition in tissues, while increasing urinary excretion (Vincent 2000; 2010), which can lead to a slight deficiency in animals. In such case, the ability of LMWCr to enhance insulin recognition by target cells may be impaired. Therefore, the supplementation of Cr for broilers can promote physiological modifications in endocrine and metabolic pathways, as well as alterations in the expression of specific genes to promote endogenous heat dissipation to the exterior, all without compromising the development of broilers.
Overall, supplementation with CrMet has been found to promote various beneficial changes in broiler chickens. These changes include a reduction in body temperature, serum corticosterone and HSP-70 expression in muscle. Furthermore, an increase in serum concentrations of T3 and T4 was observed, along with a corresponding increase in muscle IGF-1 concentrations. These physiological changes have a positive impact on broiler performance, as was observed in the findings by the same authors (Dalólio et al. 2021), which are summarised in Table 8.
In conclusion, supplementation with 0.80 mg/kg is recommended to enhance broiler performance, optimise hormonal profile, reduce HSP-70 expression, and increase IGF-1 concentrations in the breast tissue of broilers exposed to HS during the period from 22 to 43 days of age.
Declaration of funding
The resources necessary for conducting the experiment were provided by CAPES and CNPQ, under the guidance of Professor Dr Luiz Fernando Teixeira Albino. Additionally, Zinpro Corporation contributed by donating the mineral CrMet.
Acknowledgements
The authors are grateful to the Coordination for the Improvement of Higher Education Personnel (CAPES – Coordenação de Aperfeiçoamento de Pessoal de Nível Superior); to Federal University of Viçosa (UFV); to the National Council for Scientific and Technological Development (CNPq – Conselho Nacional de Desenvolvimento Científico e Tecnológico); and to the Minas Gerais Research Support Foundation (FAPEMIG – Fundação de Amparo à Pesquisa de Minas Gerais).
References
Akdemir F, Sahin N, Orhan C, Tuzcu M, Sahin K, Hayirli A (2015) Chromium–histidinate ameliorates productivity in heat-stressed Japanese quails through reducing oxidative stress and inhibiting heat-shock protein expression. British Poultry Science 56, 247-254.
| Crossref | Google Scholar | PubMed |
Almeida VV, Berenchtein B, Costa LB, Tse MLP, Braz DB, Miyada VS (2010) Ractopamine, chromium-methionine and their combinations as metabolism modifier feed additives of growing and finishing pigs. Brazilian Journal of Animal Science 39, 1969-1977.
| Crossref | Google Scholar |
Altan Ö, Pabuçcuoğlu A, Altan A, Konyalioğlu S, Bayraktar H (2003) Effect of heat stress on oxidative stress, lipid peroxidation, and some stress parameters in broilers. British Poultry Science 44, 545-550.
| Crossref | Google Scholar | PubMed |
Anderson RA (1997) Chromium as an essential nutrient for humans. Regulatory Toxicology and Pharmacology 26, S35-S41.
| Crossref | Google Scholar | PubMed |
Anderson RA, Allen J (1994) Nutrition of macrominerals and trace elements. In ‘Functional foods: designer foods, pharmafoods, nutraceuticals’. (Ed. I Goldberg), pp. 323–354. (Springer: Boston, MA, USA) doi:10.1007/978-1-4615-2073-3_15
Arif H, Hussain I, Mahmood MA, Abd El-Hack ME, Swelum AA, Alagawany M, Mahmoud AH, Ebaid H, Komany A (2019) Effect of varying levels of chromium propionate on growth performance and blood biochemistry of broilers. Animals 9, 935.
| Crossref | Google Scholar | PubMed |
Bahrami A, Moeini MM, Ghazi SH, Targhibi MR (2012) The effect of different levels of organic and inorganic chromium supplementation on immune function of broiler chicken under heat-stress conditions. Journal of Applied Poultry Research 21, 209-215.
| Crossref | Google Scholar |
Borges SA, Maiorka A, Silva AVF (2003) Heat stress physiology and electrolytes for broilers. Ciência Rural 33, 975-981.
| Crossref | Google Scholar |
Cedraz H, Gromboni JGG, Garcia Junior AAP, Farias Filho RV, Souza TM, Oliveira ER, Oliveira EB, Nascimento CS, Meneghetti C, Wenceslau AA (2017) Heat stress induces expression of HSP genes in genetically divergent chickens. PLoS ONE 12, e0186083.
| Crossref | Google Scholar | PubMed |
Cobb-Vantress (2013) ‘Broiler Management Guide.’ (Cobb-Vantress Inc.: Siloam Springs, AR, USA). Available at https://www.cob-vantress.com/
Cruzat VF, Donato Júnior J, Tirapegui J, Schneider CD (2008) Hormônio do crescimento e exercício físico: considerações atuais. Brazilian Journal of Pharmaceutical Sciences 44, 549-562.
| Crossref | Google Scholar |
Daher R, Yazbeck T, Jaoude JB, Abboud B (2009) Consequences of dysthyroidism on the digestive tract and viscera. World Journal of Gastroenterology 15, 2834-2838.
| Crossref | Google Scholar | PubMed |
Dalólio FS, Albino LFT, Silva JN, Campos PHRF, Lima HJ, Moreira J, Ribeiro Júnior V (2018) Dietary chromium supplementation for heat-stressed broilers. World’s Poultry Science Journal 74, 101-116.
| Crossref | Google Scholar |
Dalólio FS, Albino LFT, Silva JN, Fireman AKAT, Burin Júnior AM, Busanello M, Ribeiro Júnior V (2021) Dietary chromium-methionine supplementation and broiler (22–43 days) responses during heat stress. 1. Growth performance and carcass yield, metabolisable energy and serum biochemistry. Animal Production Science 61, 586-595.
| Crossref | Google Scholar |
Das R, Sailo L, Verma N, Bharti P, Saikia J, Imtiwati, Kumar R (2016) Impact of heat stress on health and performance of dairy animals: a review. Veterinary World 9, 260-268.
| Crossref | Google Scholar | PubMed |
Del Vesco AP, Gasparino E, Oliveira Neto AR, Guimarães SEF, Marcato SMM, Voltolini DM (2013) Dietary methionine effects on IGF-I and GHR mRNA expression in broilers. Genetics and Molecular Research 12, 6414-6423.
| Crossref | Google Scholar | PubMed |
Del Vesco AP, Gasparino E, Grieser DO, Zancanela V, Voltolini DM, Khatlab AS, Guimarães SE, Soares MA, Oliveira Neto AR (2015) Effects of methionine supplementation on the expression of protein deposition-related genes in acute heat stress-exposed broilers. PLoS ONE 25, e0115821.
| Crossref | Google Scholar |
Ebrahimzadeh SK, Farhoomand P, Noori K (2012) Immune response of broiler chickens fed diets supplemented with different levels of chromium methionine under heat stress conditions. Asian-Australasian Journal of Animal Science 25, 256-260.
| Crossref | Google Scholar |
Ezzat W, Abdallah EA, Rizk AM, Ouda MMM, Abd El-Krim RE (2017) Impact of chromium picolinate supplementation on productive performance, immune response, and heat shock proteins of broiler chickens under heat-stress condition. Egypt Poultry Science Journal 37, 559-583.
| Google Scholar |
Fu WJ, Hu J, Spencer T, Carroll R, Wu G (2006) Statistical models in assessing fold change of gene expression in real-time RT-PCR experiments. Computational Biology and Chemistry 30, 21-26.
| Crossref | Google Scholar | PubMed |
Ghazi SH, Habibian M, Moeini MM, Abdolmohammadi AR (2012) Effects of different levels of organic and inorganic chromium on growth performance and immunocompetence of broilers under heat stress. Biological Trace Element Research 146, 309-317.
| Crossref | Google Scholar | PubMed |
Giloh M, Shinder D, Yahav S (2012) Skin surface temperature of broiler chickens is correlated to body core temperature and is indicative of their thermoregulatory status. Poultry Science 91, 175-188.
| Crossref | Google Scholar | PubMed |
Godini A, Ghasemi A, Zahediasl S (2015) The possible mechanisms of the impaired insulin secretion in hypothyroid rats. PLoS ONE 10, e0131198.
| Crossref | Google Scholar | PubMed |
Gupta SC, Siddique HR, Mathur N, Vishwakarma AL, Mishra RK, Saxena DK, Chowdhuri DK (2007) Introduction of Hsp70, alteration in oxidative stress markers, and apoptosis against dichlorvos exposure in transgenic Drosophila melanogaster: modulation by reactive oxygen species. Biochimica et Biophysica Acta 1770, 1382-1394.
| Crossref | Google Scholar | PubMed |
Hayat K, Bodinga BM, Han D, Yang X, Sun Q, Aleya L, Abdel-Daim MM, Yang X (2020) Effects of dietary inclusion of chromium propionate on growth performance, intestinal health, immune response, and nutrient transporter gene expression in broilers. Science of The Total Environment 705, 135869.
| Crossref | Google Scholar | PubMed |
He SP, Arowolo MA, Medrano RF, Li S, Yu QF, Chen JY, He JH (2018) Impact of heat stress and nutritional interventions on poultry production. World’s Poultry Science Journal 74, 647-664.
| Crossref | Google Scholar |
Jahanian R, Rasouli E (2015) Dietary chromium methionine supplementation could alleviate immunosuppressive effects of heat stress in broiler chicks. Journal of Animal Science 93, 3355-3363.
| Crossref | Google Scholar | PubMed |
Kumari KNR, Nath DN (2018) Ameliorative measures to counter heat stress in poultry. World’s Poultry Science Journal 74, 117-130.
| Crossref | Google Scholar |
Li R, Zhou Y, Li Y, Guo L, Zhang Y, Qi Z (2018) Effects of chromium picolinate supplementation on growth performance, small intestine morphology, and antioxidant status in ducks under heat stress conditions. International Journal of Morphology 36, 226-234.
| Crossref | Google Scholar |
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402-408.
| Crossref | Google Scholar | PubMed |
Lu L, Zhao LL, Dong SY, Liao XD, Dong XY, Zhang LY, Luo XG (2019) Dietary supplementation of organic or inorganic chromium modulates the immune responses of broilers vaccinated with avian influenza virus vaccine. Animal 13, 983-991.
| Crossref | Google Scholar | PubMed |
Martinez B, Ortiz RM (2017) Thyroid hormone regulation and insulin resistance: insights from animals naturally adapted to fasting. Physiology 32, 141-151.
| Crossref | Google Scholar | PubMed |
Norain TM, Ismail IB, Abdoun KA, Al-Haidary AA (2013) Dietary inclusion of chromium to improve growth performance and immune-competence of broilers under heat stress. Italian Journal of Animal Science 12, 562-566.
| Crossref | Google Scholar |
NRC (1997) ‘The role of chromium in animal nutrition.’ (National Academies Press: Washington, DC, USA) doi:10.17226/5778
Orhan C, Akdemir F, Sahin N, Tuzcu M, Komorowski JR, Hayirli A, Sahin K (2012) Chromium histidinate protects against heat stress by modulating the expression of hepatic nuclear transcription factors in quail. British Poultry Science 53, 828-835.
| Crossref | Google Scholar | PubMed |
Phalen DN, Mitchell ME, Cavazos-Martinez ML (1996) Evaluation of three heat sources for their ability to maintain core body temperature in the anesthetized avian patient. Journal of Avian Medicine and Surgery 10, 174-178 Available at http://www.jstor.org/stable/30133092.
| Google Scholar |
Rajkumar U, Vinoth A, Reddy EPK, Shanmugan M, Rao SVR (2018) Effect of supplemental trace minerals on HSP70 mRNA expression in commercial broiler chickens. Animal Biotechnology 29, 20-25.
| Crossref | Google Scholar |
Rao SVR, Raju MVLN, Panda AK, Poonam NS, Murthy OK, Sunder GS (2012) Effect of dietary supplementation of organic chromium on performance, carcass traits, oxidative parameters, and immune responses in commercial broiler chickens. Biological Trace Element Research 147, 135-141.
| Crossref | Google Scholar | PubMed |
Rao SVR, Prakash B, Raju MVLN, Panda AK, Kumari RK, Reddy EPK (2016) Effect of supplementing organic forms of zinc, selenium, and chromium on performance, antioxidant, and immune responses in broiler chickens reared in tropical summer. Biological Trace Element Research 172, 511-520.
| Crossref | Google Scholar | PubMed |
Richards SA (1971) The significance of changes in the temperature of the skin and body core of the chicken in the regulation of heat loss. Journal of Physiology 216, 1-10.
| Crossref | Google Scholar | PubMed |
Roll VFB, Lopes LL, Rossi P, Anciuti MA, Rutz F, Xavier EG, Silva SS (2010) Hematology of broilers fed diets containing aflatoxins and mycotoxin adsorbent. Archivos de Zootecnia 59, 93-101.
| Crossref | Google Scholar |
Ryu ST, Park BS, Bang HT, Kang HK, Hwangbo J (2016) Effects of anti-heat diet and inverse lighting on growth performance, immune organ, microorganism, and short-chain fatty acids of broiler chickens under heat stress. Journal of Environmental Biology 37, 185-192.
| Google Scholar | PubMed |
Sacheck JM, Ohtsuka A, McLary SC, Goldberg AL (2004) IGF-I stimulates muscle growth by suppressing protein breakdown and expression of atrophy-related ubiquitin ligases, atrogin-1 and MuRF1. American Journal of Physiology - Endocrinology and Metabolism 287, E591-E601.
| Crossref | Google Scholar | PubMed |
Safwat AM, Elnaggar AS, Elghalid OA, EL-Tahawy WS (2020) Effects of different sources and levels of dietary chromium supplementation on performance of broiler chicks. Animal Science Journal 91, e13448.
| Crossref | Google Scholar | PubMed |
Sahin K, Sahin N, Onderic M, Gursu F, Cikim G (2002) Optimal dietary concentration of chromium for alleviating the effect of heat stress on growth, carcass qualities, and some serum metabolites of broiler chickens. Biological Trace Element Research 89, 53-64.
| Crossref | Google Scholar | PubMed |
Sahin K, Sahin N, Küçük O (2003) Effects of chromium and ascorbic acid supplementation on growth, carcass traits, serum metabolites, and antioxidant status of broiler chickens reared at a high environmental temperature (32°C). Nutrition Research 23, 225-238.
| Crossref | Google Scholar |
Sahin N, Akdemir F, Tuzcu M, Hayrli A, Smith MO, Sahin K (2010) Effects of supplemental chromium sources and levels on performance, lipid peroxidation, and proinflammatory markers in heat-stressed quails. Animal Feed Science and Technology 159, 143-149.
| Crossref | Google Scholar |
Sahin N, Hayrli A, Orhan C, Tuzcu M, Akdemir F, Komorowski JR, Sahin K (2017) Effects of supplemental chromium form on performance and oxidative stress in broilers exposed to heat stress. Poultry Science 96, 4317-4324.
| Crossref | Google Scholar | PubMed |
Sahin N, Hayirli A, Orhan C, Tuzcu M, Komorowski JR, Sahin K (2018) Effects of the supplemental chromium form on performance and metabolic profile in laying hens exposed to heat stress. Poultry Science 97, 1298-1305.
| Crossref | Google Scholar | PubMed |
Saleh AA, Ragab MM, Ahmed EAM, Abudabos AM, Ebeid TA (2018) Effect of dietary zinc–methionine supplementation on growth performance, nutrient utilization, antioxidative properties and immune response in broiler chickens under high ambient temperature. Journal of Applied Animal Research 46, 820-827.
| Crossref | Google Scholar |
SAS Institute, Inc. (2012) SAS OnDemand for Academics. Release 9.04.01M5P09132017. SAS Institute Inc., Cary, NC, USA. Available at hhttps://odamid.oda.sas.com/SASStudio/
Siegel HS (1995) Stress, strains and resistance. British Poultry Science 36, 3-22.
| Crossref | Google Scholar | PubMed |
Silva SRG, Abreu MLT, Lopes JB, Leal DIB, Almendra SNO, Silva SMMS, Costa SEM (2014) Desempenho e resposta imune de frangos de corte alimentados com dietas suplementadas com cromo na forma orgânica. Revista Brasileira de Medicina Veterinária 21, 199-203.
| Google Scholar |
Steibel JP, Poletto R, Coussens PM, Rosa GJM (2009) A powerful and flexible linear mixed model framework for the analysis of relative quantification RT-PCR data. Genomics 94, 146-152.
| Crossref | Google Scholar | PubMed |
Valente Junior DT, Barbosa LMR, Soares MH, Rodrigues GA, Gomes M, Silva CB, Teixeira LM, Cunha Júnior RL, Abranches FF, Saraiva A (2021) Dietary supplementation of chromium for finishing pigs. Ciência Rural 51, e20200554.
| Crossref | Google Scholar |
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3, 1-12.
| Crossref | Google Scholar |
Vignale K, Caldas JV, England JA, Boonsinchai N, Magnuson A, Pollock ED, Dridi S, Owens CM, Coon CN (2017) Effect of white striping myopathy on breast muscle (Pectoralis major) protein turnover and gene expression in broilers. Poultry Science 96, 886-893.
| Crossref | Google Scholar | PubMed |
Vincent JB (2000) The biochemistry of chromium. The Journal of Nutrition 130, 715-718.
| Crossref | Google Scholar | PubMed |
Vincent JB (2001) The bioinorganic chemistry of chromium (III). Polyhedron 20, 1-26.
| Crossref | Google Scholar |
Vincent JB (2010) Chromium: celebrating 50 years as an essential element? Dalton Transactions 39, 3787-3794.
| Crossref | Google Scholar | PubMed |
Vincent JB (2017) New evidence against Chromium as an essential trace element. The Journal of Nutrition 147, 2212-2219.
| Crossref | Google Scholar | PubMed |
Wasti S, Sah N, Mishra B (2020) Impact of heat stress on poultry health and performances, and potential mitigation strategies. Animals 10, 1266.
| Google Scholar |
Wen C, Jiang X, Ding L, Wang T, Zhou Y (2017) Effects of dietary methionine on breast muscle growth, myogenic gene expression and IGF-I signaling in fast- and slow-growing broilers. Scientific Reports 7, 1924.
| Crossref | Google Scholar |
Williams CH, David DJ, Iismaa O (1962) The determination of chromic oxide in faeces samples by atomic absorption spectrophotometry. Journal of Agricultural Science 59, 381-385.
| Crossref | Google Scholar |
Youssef IMI, Abdo IMI, Elsukkary HFA, El-Kady MF, Elsayed M (2022) Effects of dietary supplementation of chromium methionine chelate on growth performance, oxidative stress, hematological indices, and carcass traits of broiler chickens. Tropical Animal Health and Production 54, 267.
| Crossref | Google Scholar | PubMed |
Zheng C, Huang Y, Xiao F, Lin X, Lloyd K (2016) Effects of supplemental chromium source and concentration on growth, carcass characteristics, and serum lipid parameters of broilers reared under normal conditions. Biological Trace Element Research 169, 352-358.
| Crossref | Google Scholar | PubMed |
