199 EXPRESSION OF HAPTOGLOBIN mRNA IN THE OVIDUCT DURING THE OESTRUS CYCLE OF SOWS
M. C. Ramón A , O. S. Acuña A , M. J. Ruano A , M. Avilés A and M. J. Izquierdo-Rico ADepartment of Cell Biology and Histology, Faculty of Medicine, University of Murcia, Spain
Reproduction, Fertility and Development 25(1) 248-248 https://doi.org/10.1071/RDv25n1Ab199
Published: 4 December 2012
Abstract
The haptoglobin is an acute phase protein that has been recently related with numerous events of mammalian reproduction. The objective of this study was to determine whether haptoglobin mRNA is expressed in the porcine oviduct and to analyse its expression during the different phases of the oestrus cycle. Porcine oviducts collected from a local abattoir were classified based on follicular morphology: prepuberal (containing only follicles 1 to 2 mm in diameter), preovulatory (containing 6 to 12 follicles 8 to 12 mm in diameter), post-ovulatory (containing 6 to 12 hemorrhagic corpora), and luteal phase (containing 6 to 12 corpora lutea). Total RNA was obtained by extracting scraps of isthmus-ampullar junction mucosa using RNAqueous® kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions and cDNA was synthesised with an oligo d(T) as primer. This cDNA was used as template in RT-PCR and quantitative PCR (qPCR) amplifications using specific primers (Fw: gctacgtggagcacatggtt and Rv: ggagattcttagccgtggtc for RT-PCR and Fw: ggtgatgcccatttgcctccct and Rv: cagccaccggcagcatgaca for qPCR) designed based on GenBank sequence for Sus scrofa haptoglobin (NM_214000). The amplification by RT-PCR resulted in a 312-bp amplicon. This PCR product was sequenced and a 100% of identity with porcine haptoglobin sequence deposited in GenBank database was confirmed. On the other hand, analysis by qPCR revealed that the haptoglobin mRNA expression was more elevated in luteal and post-ovulatory phases than in prepuber and preovulatory phases. In conclusion, the haptoglobin mRNA is present in porcine oviduct and could be considered as a progesterone-dependent transcript. The role played by this protein in the porcine oviduct remains to be investigated.
This study was supported by MICINN (AGL2009-12512-C02-01-02).