151 HORSE EMBRYO BIOPSY: EFFECT ON PREGNANCY RATES AND SUCCESSFUL SEX DETERMINATION DEPENDING ON THE SIZE OF THE EMBRYO

Abstract

Commercial horse embryo transfer centers in certain parts of the world are in need of different procedures to streamline their production, for instance, by transferring only sexed embryos. A possible method to do so is PCR sex determination of biopsied embryos. The aim of this study was to (1) evaluate the impact of embryo biopsy on pregnancy rates with regard to embryo size; and (2) assess the feasibility of determining the sex of the embryo with that sample. Horse embryos were produced by artificial insemination. Embryos were recovered by transcervical uterine flush on day 7 after ovulation, packaged in a warm insulated container in holding medium and shipped for a 1-hour transit to the laboratory. Upon arrival, embryos were measured using an eyepiece. Embryos were classified into three different groups based on their size: I, 150–350 µm; II, 350–550 µm; III, >550 µm (the largest being 1316 µm). Biopsy was performed on the lid of a 60-mm petri dish filled with 4 mL of TALP-H on an inverted microscope. Embryos were held with a holding pipette and biopsied with a 15 ± 5 µm pipette with a 45° angle and a spike. Trophoblastic cells were aspirated (5–15 cells) and then placed in a 5-µL drop of TALP-H. Samples were placed in a 0.5-mL tube and frozen for PCR sex determination analysis. Biopsied embryos were shipped back to the center in 1-mL equilibrated DMEM/F12 with 10% FBS and 1% antiobiotic-antimycotic. Each embryo was immediately transferred transcervically to a synchronized recipient mare. Pregnancies were evaluated by transrectal ultrasound 7 days post-transfer and reassessed at Day 60. A nested PCR was performed using primers for sex-determining region Y (SRY, 1F ACATACCGTTCTCGGCTCTG, 4R CTTCCGACGAGGTCGATATT, 2R TCTGTGCCTCCTCGAAGAAT, and 3F ATCCCTACTTTGGACGAGCA) and amelogenin (AME, 1F CTTGCAGCCTCATCACCATA, 4R GAGGCAGGTCAGGAAGCATA, 2R GAATATCGGAGGCAGAGGTG, and 3F AACCAATGATGCCACTTCCT) to determine the sex of the embryo. The PCR products were evaluated by agarose gel. The presence of both products indicated that the embryo was male and the presence of amelogenin only that was female. No differences in amelogenin amplicon size between both sexes were detected. Results were compared using chi-square test (P < 0.05). No statistical differences were observed in pregnancy rates among groups (I: 13/22, 59.1%; II: 15/20, 75%; III: 10/19, 52.6%), although a slight tendency was observed towards an increase in the pregnancy rate when group II embryos were biopsied compared to group III (P = 0.14). Successful sex determination showed statistical differences between group II and the others (I: 10/22, 45.5%; II: 16/20, 80%; III: 8/19, 42.1%), given that more embryos from group II could be sexed. This work suggests that horse embryo viability after damaging the capsule is independent of the size of the embryo before the biopsy, although it might be easier to collect a proper sample of trophoblastic cells from embryos between 350 and 550 µm to determine their sex since smaller embryos collapsed rapidly during aspiration, and trophoblastic cells are tightly attached to one another in larger embryos.