Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor*

Elisabeth A. Owen; Max A. Keniry

doi:10.1071/CH09169

RESEARCH ARTICLE

Previous Next Contents Vol 62(11)

Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor*

Elisabeth A. Owen ^A and Max A. Keniry ^A ^B

+ Author Affiliations

- Author Affiliations

^A Research School of Chemistry, Australian National University, Canberra, ACT 0200, Australia.

^B Corresponding author. Email: max@rsc.anu.edu.au

Australian Journal of Chemistry 62(11) 1544-1549 https://doi.org/10.1071/CH09169
Submitted: 23 March 2009 Accepted: 13 May 2009 Published: 20 November 2009

Abstract

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.

Acknowledgement

The authors thank Dr Geoff Smith for critical reading of the manuscript.

References

^* The present paper is dedicated to the memory and career of Professor Rod Rickards, co-discoverer of the calothrixins.

Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor*

Abstract

Acknowledgement

Subscriber Login